SciELO - Scientific Electronic Library Online

 
vol.33 author indexsubject indexarticles search
Home Pagealphabetic serial listing  

Services on Demand

Journal

Article

Indicators

    Related links

    • On index processCited by Google
    • On index processSimilars in Google

    Share


    African Entomology

    On-line version ISSN 2224-8854Print version ISSN 1021-3589

    AE vol.33  Pretoria  2025

    https://doi.org/10.17159/2254-8854/2025/a23513 

    RESEARCH ARTICLE

     

    Afrotropical Culicoides (Diptera: Ceratopogonidae): description of Culicoides baltusi sp. n. and Culicoides theileri sp. n., two new species related to Culicoides brucei from southern Africa

     

     

    K. LabuschagneI, II; A. van SchalkwykI; C.H. ScholtzII

    IEpidemiology. Parasites and Vectors, Onderstepoort Veterinary Research-Agricultural Research Council, Onderstepoort, South Africa
    IIDepartment of Zoology and Entomology, University of Pretoria, Pretoria, South Africa

    Correspondence

     

     


    ABSTRACT

    The genus Culicoides Latreille is represented by 160 described species in the Afrotropical region. Evidence suggests that there may be at least 30 species still need to be described in South Africa. Culicoides baltusi Labuschagne and Meiswinkelt" sp. n. and Culicoides theileri Labuschagne and Meiswinkel sp. n. are described and illustrated for both sexes from material collected in South Africa, Botswana, Namibia and Zimbabwe since 1990. We propose that both species be placed in the subgenus Culicoides Latreille. Morphological and molecular evidence indicate that these two species are related to Culicoides brucei Austen. Culicoides theileri sp. n. is restricted to the drier western areas of the Northern and Western Cape provinces, while C. baltusi sp. n. on the other hand is widely distributed across southern Africa, as is C. brucei. These three species can be separated based on size and wing pattern. Breeding habitat of all three species is not known. Published research utilising precipitin tests and PCR indicate that the adult female blood feeding preferences of C. baltusi sp. n. and C. brucei are large mammals, including bovines and equids. Those of C. theileri sp. n. are not known, though it likely also feeds on large mammals. Extensive light trap data, collected over 30 years, were extracted from the National Collection of Insects of Veterinary Importance (NCIVI) database and are used to map the distribution ranges of C. baltusi sp. n., and C. theileri sp. n. and C. brucei in southern Africa. The description of these two new species increases our understanding of the diversity and distribution of Culicoides species in southern Africa.

    Keywords: taxonomy, morphology, new species description, DNA barcoding, map


     

     

    INTRODUCTION

    There are 160 species of Culicoides Latreille, known to occur in the Afrotropical region (Borkent and Dominiak 2020), but a significant number remain undescribed (Meiswinkel 1995, Meiswinkel et al. 2004, Labuschagne 2015). Culicoides brucei Austen, was first described from Uganda by Austen in 1909 and placed in the subgenus Culicoides (Austen 1909). In the Afrotropical region, C. brucei is related to C. magnus Colaco, C. sylvicola Khamala and Kettle, and C. sellersi Boorman and Dipeolu, of which only C. magnus has been recorded in southern Africa (Glick 1990). Both C. magnus and C. brucei are widespread throughout southern Africa. These two species can be distinguished by wing pattern and the presence of sensilla coeloconica on the flagellomeres. Culicoides brucei has sensilla coeloconica on each of flagellomeres 1, 9-13, while they are present on 1, 5, 7, 9-13 in C. magnus (Glick 1990). Glick (1990) grouped C. sylvicola with C. brucei and C. magnus, while Khamala and Kettle (1971) in their original description of this species placed it in the Milnei group based on the 3rd palpal segment, coeloconica distribution and having less defined spots and dark apices to veins M1, M2, CuA1. To accurately classify C. sylvicola in the correct subgenus or group, the male, which remains unknown, would need to be examined. Culicoides sellersi shares the wing characteristics of dark apices to veins M1, M2, CuA1 with C. sylvicola, and both species also has sensilla coeloconica on each of flagellomeres 1, 9-13 (Boorman and Dipeolu 1979). Culicoides brucei is related to the Palearctic species C. pulicaris (Linnaeus) and C. punctatus (Meigen), both vectors of bluetongue virus (BTV) in Europe as well as to the economically important C. impunctatus Goetghebuer, also known as the Highland midge in Scotland, where large numbers of this species attack humans during the summer months (Blackwell 2001).

    It is suspected that C. brucei and C. magnus may play a role in the transmission of orbiviruses in the field. African horse sickness virus (AHSV) was isolated, from field collected specimens of C. brucei after these were fed on a high titre of AHSV (Venter et al. 2009). Similarly, AHSV, bluetongue virus (BTV), epizootic haemorrhagic disease virus (EHDV) and equine encephalosis virus (EEV) have been isolated from C. magnus in the laboratory (Nevill et al. 1992; Paweska et al. 2003, 2004, 2005; Paweska and Venter 2004, Venter et al. 2004, 2009). The vector capacity of the two new species being described is not known.

    Here we describe two new species, C. baltusi sp. n. and C. theileri sp. n., and compare them to the related species, C. brucei, based on morphological and molecular characteristics. Culicoides baltusi sp. n. is named after Dr Baltus Erasmus and C. theileri sp. n. is named after Sir Arnold Theiler in honour of their research on the viruses causing bluetongue and African horse sickness.

     

    MATERIALS AND METHODS

    Collection

    Culicoides species were collected using the Onderstepoort Veterinary Research (OVR) black light suction traps during field surveys over the last 30 years. These collections were analysed by separating the Culicoides species from the other insects, all Culicoides was identified morphologically to species level, sexed and the females age-graded according to Dyce (1969). The results were recorded into a Microsoft Access database; data are then extracted from the database for the generation of distribution maps and other research applications. Specimens are routinely mounted using the method of Meiswinkel (1995) and mounted specimens are added to the National Collection of Insects of Veterinary Importance (NCIVI) housed at the Agricultural Research Council-Onderstepoort Veterinary Research (ARC-OVR).

    Mounting

    Culicoides specimens are slide-mounted in Canada balsam using the method described by Meiswinkel (1995). The wings are dissected off and mounted onto a clean and labelled microscope slide in a 50:50 phenol-Canada balsam mixture. The rest of the midge is cleared in 10% potassium hydroxide (KOH) for 18-24 hours, neutralized and dehydrated in 10% acetic acid for 30 minutes, washed in 96% ethanol for a few hours and then stored in clove oil for 12 hours. The specimen is then dissected into the following parts: antennae separated from the head, head, abdomen, legs and scutum. These are then mounted onto the same microscope slide as the wings and left to dry for two to three months until completely dry. After drying a small drop of phenol-Canada balsam mixture is placed on each component, these are then covered with an appropriately sized coverslip, due care being taken not to damage or squash the specimen. The slide is then left to dry for at least three months, to prevent coverslip movement with resultant damage to the specimen, before being examined under the compound microscope (Meiswinkel 1995).

    Description of characters

    Thirty-three slide-mounted specimens (21 females and 11 males) of C. baltusi sp. n., 112 (79 females and 33 males) of C. theileri sp. n, and 34 (29 females and 5 males) of C. brucei were examined for the description of the two new species. Specimens were examined using a Zeiss Axiostar compound microscope equipped with an ocular reticule for measurements. All measurements are in micrometres (μηι), except for wing lengths (mm). Photographs were taken using a Zeiss AxioCam ERc5s camera, and measurements were performed in ZEN 2.3lite. In general, the descriptive taxonomic terminology follows Khamala and Kettle (1971) and Boorman (1989), with two exceptions: (i) the flagellar segments are numbered 1-13 (instead of 3-15), and (ii) the proboscis/head (P/H) ratio is used instead of the inverse (H/P). P presents the distance from the tip of the proboscis to the tormae, and H presents the distance from the tormae to the insertion alveolus of the interocular seta. Terms for the various types of sensilla situated on the flagellum follow Meiswinkel (1995). Excel spreadsheets were used to collate the measurement data for the characters of each species. The description of each species was done in a word document.

    Map generation

    The distribution map of C. baltusi sp. n., C. theileri sp. n. and C. brucei in southern Africa was generated using QGIS 22.7 software (http://qgis.osgeo.org). The shapefiles for southern Africa, as well as the provinces of South Africa were used for the map visualisation. Distribution data were extracted from the NCIVI database to an excel spreadsheet for the three species and the data represented as a pie chart for each collection site in the map.

    Molecular

    Total DNA extracts were obtained from individual Culicoides using the ZR Tissue and Insect DNA Miniprep kit (Zymo Research), following the manufacturer's instructions. A 700 bp region of the mitochondrial cytochrome c oxidase I gene was amplified using the primers LC01490: 5'-G GTCAACAAATCATAAAGATATTG G-3' and HC0219: 5'-TAAACTTCAGGGTGACCAAAAAATCA-3' as previously described (Folmer et al. 1994). Individual reactions were performed using Terra PCR direct polymerase mix (Takara, Clontech) at an annealing temperature of 55°C as previously described by Labuschagne et al. (2023). Amplicons were submitted for Sanger sequencing to Inqaba Biotech (Pretoria, South Africa), using the same PCR primers, in BigDye Terminator v3.1 cycle sequencing reactions (Applied Biosystems, Foster City, CA) and analysed on an ABI3500-XL Genetic analyzer.

    Consensus COI gene sequences, representing individual specimens, of C. baltusi sp. n. (n = 19), C. theileri sp. n. (n = 11), C. brucei (n = 8), and C. magnus (n = 3), were generated by assembling the forward and reverse sequences in CLC Genomics Workbench 9.0.1 (Qiagen Aarhus). An alignment containing all COI consensus sequences, as well as selected reference sequences obtained from GenBank was constructed in Mega X using Clustal W (Tamura et al. 2013). The sequences included in the analyses represent the Similis group, subgenus Avaritia and the Milnei group (Supplementary Table 2). The best fitting model was determined using Mega X, and a General Time Reversible model with Gamma distribution (4) and Invariant sites (G+I) was used to compute the Maximum Likelihood phylogeny with 1000 bootstrap replicates. Percentage sequence identity was determined between C. baltusi sp. n., C. theileri sp. n., C. brucei, and the other GenBank sequences using CLC Genomics Workbench 9.0.1. (www.CLCgenomics.com).

     

    RESULTS

    TAXONOMY

    Diagnosis of the Brucei group (Glick 1990)

    Female: Eyes usually contiguous for H to 2 ommatidia; sensilla coeloconica usually on each of flagellomeres 1, 9-13 or, in the case of C. magnus 1, 5, 7, 9-13. Third segment of maxillary palpus narrow to moderately swollen, with scattered sensilla on ventral side, or grouped in shallow, irregular to round sensory pits. Hindtibial comb with 5-7 spines, number of spines can vary greatly even in the same specimen (one specimen can have 5 spines on one hindleg and 7 on the other). Female abdomen with 2 slightly unequal, ovoid spermathecae and rudimentary 3rd spermatheca with a sclerotised ring present at junction of ducts. Wing with prominent dark and pale markings. Dark spot in middle of cell cua1, surrounded by a pale ring-like area. 2nd radial cell ending in pale 2nd costal spot.

    Male genitalia: Ninth tergum with short apicolateral processes, caudal margin variable from straight to round. Gonocoxite usually with a short ventral root and moderately long dorsal root, the inner margin of gonocoxite is spinose (prominent area of setae or spines). Aedeagus with moderately broad, deep basal arch, distal median process stout or tapering to a rounded or blunt apex. Parameres separate, usually sharply bent laterally near base, stem usually moderately long and slender, tapering distally to a slender, pointed apex with minute setae. Ventral membrane bare.

    Culicoides baltusi Labuschagne and Meiswinkel sp. n.

    (Figures 1, 2, 7, 8, Table 1, 2 and Supplementary Table 1)

    Type material examined

    (21 females, 11 males)

    Holotype: Female accession number RSA1421: South Africa: Eastern Cape Province; Middelburg, GPS: 25.81, -31.29, 27/ix/84, P. Trollip, collected with OVI light trap at sheep. Deposited in ARC-Onderstepoort Veterinary Research, EPV, National Insect Collection, South Africa.

    Paratypes: South Africa: Eastern Cape Province; Middelburg, GPS: 25.81, -31.29, 7/ii/1984, P. Trollip, 2 females, 2 males. Accession numbers RSA1422 to RSA1425.

    Other specimens examined: Western Cape Province; Lamberts Bay, Verlorenvlei, GPS: 18.37, -32.32, 3/v/1987, R. Meiswinkel, 1 female; Piketberg, Moutonshoek, GPS: 18.71, -32.72, 7/iii/2007, B. van der Merwe, 1 female; Uniondale, Bo-Jakkals Kloof, GPS: 23.26, -33.69, 27/xii/2023, J. Esterhuizen, 3 males; Northern Cape Province; Springbok, GPS: 17.88, -29.67, 16/x/2008, 4/xi/2008, 18/xi/2008, 17/ii/2009, C. Schutte, 14 females, 4 males; KwaZulu-Natal; Cathedral Peak, GPS: 29.13, -28.92, 21/ix/1988, I. Pajor, 1 male ; Underberg, GPS: 29.44, -29.76, 2/iii/2003, K Labuschagne, 1 female; Limpopo Province; Modimolle (Nylstroom), GPS: 28.40, -24.70, 30/ix/1996, R. Meiswinkel, 1 female, 1 male. Accession numbers RSA1420, RSA1429, RSA1437 to RSA1457, RSA4184 to RSA4186.

    ZooBank registration: To comply with the regulations set out in article 8.5 of the amended 2012 version of the International Code of Zoological Nomenclature (ICZN 2012), details of the new species have been submitted to ZooBank. The Life Science Identifier (LSID) of the article is urn:lsid:zoobank. org:pub:03ABA088-882C-4E87-99BB-3B6473C68B33. The LSID for the new name Culicoides baltusi is urn:lsid:zoobank.org:act:016811CD-E4E0-4CDB-AB4D-772716A432B0.

    Differential Diagnosis

    Medium-sized species, female eyes contiguous. Wing with prominent dark and pale markings, dark spot in cell cua1 surrounded by pale ring-like spot, large pale spot reaching wing margin in cell r3, 2nd radial cell ending in the pale 2nd costal spot. Female antenna with sensilla coeloconica on each of flagellomeres 1, 9-13. Third segment of maxillary palpus with scattered sensilla grouped in round to irregular shallow pits. Hindtibial comb with 6 spines. Female abdomen with 2 ovoid spermathecae and a rudimentary 3rd spermatheca; sclerotised ring present at junction of ducts. Male: Ninth tergum with small apicolateral processes, caudal margin variable from straight to round. Gonocoxite usually with short ventral root and moderately long dorsal root, inner margin of gonocoxite spinose. Aedeagus with distal median process stout or tapering to a rounded or blunt apex. Parameres separate, usually sharply bent laterally near base, stem usually moderately long and slender, tapering distally to a slender, pointed apex with minute setae. Ventral membrane bare.

    Description

    Female (n = 21)

    Head: Eyes (Figure 1C): bare, contiguous for 1 ommatidia. Flagellum (Figure 1B): lengths of flagellomeres: 64/53/54/54 /58/54/55/54/71/76/82/87/122 μηι. Mean antennal ratio (AR) 0.98 (0.87-1.03). Mean number and distribution of sensilla coeloconica on flagellomeres 1-13: 3.5/0/0/0/0/0/0/0/1/1/1.1/2 .1/3; range in number of sensilla coeloconica on flagellomeres 1-13: 3-4/0/0/0/0/0/0/0/1-2/1-2/1-2/2-3/2-4. Number of sensilla coeloconica on flagellomeres: 12 (10-16). Number and distribution of sensilla chaetica on flagellomeres 1-13: 8/6/6/6/6/7/6/6/2/2/1/0/0. Number and distribution of long and short blunt-tipped sensilla trichodea on flagellomeres 1-8: two long (LL) on flagellomere 1, two long (LL) and one short (c) on flagellomeres 2-8. Palpus (Figure 1D) with lengths of segments 1+2-5: 89/91/30/35. Mean palpal ratio (PR) 2.6 (2.34-2.73); third segment slender, only slightly expanded distally, distal portion with many small, shallow sensory pits, often also with 1 or 2 larger pits. Mean P/H ratio 0.75 (0.72-0.80). Mandible with 14 (13-15)) teeth (Figure 11).

    Thorax: No thoracic pattern visible in slide-mounted specimens (Figure 1E). Halters pale. Wing (Figure 1A): Mean length 1.58 mm (1.36-1.79). Mean costal ratio (CR) 0.59 (0.56-0.62). Mean wing length/width ratio 2.15 (2.1-2.25). Wing radial cells completely formed. Wing with prominent dark and pale markings; dark spot in cell cua1 surrounded by pale ring-like spot; large 3rd postigmatic pale spot reaching wing margin in cell r3; veins M1, M2 and CuA1 dark at wing margin (similar to C. sellersi); 2nd radial cell ending in the pale 2nd costal spot. Legs: (Figure 1H+G) no bands; only middle leg bearing a pair of short, erect spines apically on tarsomeres 1-3, and one on 4. Hindtibial comb with 5-6 spines, that 2nd to the spur longest. Mean tarsal ratio (T/R) 1.69 (1.45-1.78).

    Abdomen: Two, well-developed, ovoid spermathecae (Figure 1F), 3rd rudimentary and sclerotised ring (approximately 5.96 χ 2.91 μηι), slightly unequal in size, measuring 62.64 χ 43.01, 60.56 χ 36.81 and 23.86 χ 7.3 μm. The chitinous plates (Figure 1J) surrounding the gonopore are clearly visible in slide-mounted specimens.

    Male (n = 11)

    Head (Figure 2C): Eyes bare, separated by less than half the width of an ommatidia. Flagellum (Figure 2B): Lengths of flagellomeres 1-13: 116/49/48/47/46/45/45/45/42/51/116/96/118 μΓη. Mean antennal ratio (AR) 0.96 (0.88-1.03). Mean number and distribution of sensilla coeloconica on flagellomeres 1-13: 2.1/0/0/0/0/0/0/0/0/0/0.4/2.1/3.7 (differ from C. sellersi as C. sellersi has Sco on 11); range in number of sensilla coeloconica on flagellomeres 1-13: 1-4/0/0/0/0/0/0/0/0/0/0-1/2-3/2-5. Number and distribution of sensilla chaetica on flagellomeres 11-13: 5/0/0. Number and distribution of long and short-tipped sensilla trichodea on flagellomeres 1-8: one long and one short on flagellomeres 1-8. Palpus (Figure 2C): Mean PR 3.68 (3.42-4.00); third segment narrow with shallow sensory pit. Mean P/H 0.51 (0.48-0.55).

    Thorax: Scutum light brown, no thoracic pattern visible in slide-mounted specimens. Wing (Figure 2A). Mean length 1.39 (1.03-1.55) mm. Mean costal ratio (CR) 0.55 (0.53-0.56)-higher than C. sellersi. Mean wing length/width ratio 2.78 (2.58-2.98). Legs: middle leg bearing a pair of spines on apices of tarsomeres 1-4.

    Abdomen: Genitalia (Figure 2D+E) Ninth tergum with short, slender apicolateral processes, caudal margin with a narrow mesal cleft. Ninth sternum with a broad, shallow caudomedian emargination; ventral membrane not spiculate. Gonocoxite with short ventral root and moderately long dorsal root, inner margin of gonocoxite spinose. Aedeagus with a deep, V-shaped basal arch, lateral arms slender; distal median process moderately short, slender, with rounded apex. Paramere with a slender stem, tapering to a pointed apex, with minute setae.

    Etymology

    Named in honour of Dr Baltus Erasmus, for his work on bluetongue virus in South Africa.

    Immatures

    The larval habitat and immature stages of C. baltusi sp. n. remain undescribed, though the authors (unpublished) collected adults with emergence traps placed over kikuyu grass-covered, waterlogged clay soils in South Africa.

    Bionomics

    The blood feeding habits of the adult female of C. baltusi sp. n. are suspected to be large mammals. Bloodmeal analysis utilising PCR by Riddin et al. (2019) indicated that this species fed on horses, though only 2 specimens were tested. Adults have been collected with light traps set at cattle kraals, sheep pens, horse stables (Meiswinkel et al. 2000; Schütte 2012) and at the Elephant, Buffalo and White Rhinoceros camps at the National Zoological Gardens of South Africa (Meiswinkel 1995; Labuschagne et al. 2007)

    Distribution

    Namibia, South Africa and Zimbabwe.

    South Africa: Eastern-, Northern- and Western Cape, Free State, KwaZulu Natal, Mpumalanga, Nort West, Gauteng and Limpopo Provinces (Figure 7).

    Biomes: Deserts and Xeric Shrublands; Mediterranean Forests, Woodlands, and Scrub; Montane Grasslands and Shrublands; Tropical and Subtropical Grasslands, Savannas, Shrublands, and Woodlands; Tropical and Subtropical Moist Broadleaf Forests (Mucina and Rutherford 2006).

    Terrestrial ecoregions: Kalahari Xeric Savanna; Nama Karoo; Namibian Escarpment Woodlands; Succulent Karoo; Albany thickets; Montane Fynbos and Renosterveld; Lowland Fynbos and Renosterveld; Drakensberg Montane Grasslands, Woodlands, Forests; Highveld Grasslands; southern Africa Bushveld; southern Miombo Woodlands; Zambezian Baikiaea Woodlands; Zambezian and Mopane Woodlands; Knysna-Amatole Montane Forests; KwaZulu-Cape Coastal Forest Mosaic; and Maputaland Coastal Forest Mosaic (Burgess et al. 2004)

    Culicoides theileri Labuschagne and Meiswinkel sp. n.

    (Figures 3, 4, 7, 8, Table 1, 2 and Supplementary Table 1)

    Material examined

    (79 females and 33 males)

    Holotype: Female accession number RSA1527: South Africa: Northern Cape Province: Alexander Bay, GPS: 16.50, -28.64, 9/iv/1997, N. Oerson, collected with OVI light trap at cattle. Deposited in ARC-Onderstepoort Veterinary Research, EPV, National Insect Collection, South Africa.

    Paratypes: South Africa: Northern Cape Province; Alexander Bay, GPS: 16.50, -28.64, 2/x/1996, 19/xii/1996, 9/iv/1997, N. Oerson, 10 females, 3 males. RSA1528-RSA1539

    Other specimens examined: Northern Cape Province; Calvinia, GPS: 19.77, -31.5, 1/x/1997, J. Jonker, 18 females, 5 males; Springbok, GPS: 17.88, -29.67, 16/x/2008, 25/xi/2008, 4/ xi/2008, 18/xi/2008, 10/ii/2009, 17/ii/2009, 12/3/2011, C. Schutte, 51 females, 25 males. Accession numbers: RSA1458 to 1526, RSA1540 to 1569.

    ZooBank registration: To comply with the regulations set out in article 8.5 of the amended 2012 version of the International Code of Zoological Nomenclature (ICZN 2012), details of the new species have been submitted to ZooBank. The Life Science Identifier (LSID) of the article is urn:lsid:zoobank. org:pub:03ABA088-882C-4E87-99BB-3B6473C68B33. The LSID for the new name Culicoides theileri is urn:lsid:zoobank.org:act: 3A4CDA1E-CD68-4284-AF7D-CC31C7572001.

    Differential diagnosis

    Female: Large species, eyes contiguous. Wing with prominent dark and pale markings, round dark spot, surrounded by a pale ring-like area in cell cua1, large pale spot reaching wing margin in cell r3, 2nd radial cell ending in a pale 2nd costal spot. Sensilla coeloconica distribution on flagellomeres 1, 9-13, occasional present on flagellomeres 3, 5 and 7. Third segment of maxillary palpus moderately inflated, with scattered sensilla grouped in round to irregular, shallow pits. Hindtibial comb with 6-8 spines. Female abdomen with 2 ovoid spermathecae and a rudimentary 3rd and sclerotised ring present at junction of ducts.

    Male: Ninth tergum with small apicolateral processes, caudal margin slightly rounded. Gonocoxite usually with short ventral root and moderately long dorsal root, inner margin of gonocoxite spinose. Aedeagus without a basal bar-like band or dorsal "peg"; distal median process stout or tapering to a rounded or blunt apex. Parameres separate, usually sharply bent laterally near base, stem usually moderately long and slender, tapering distally to a slender, pointed apex with minute setae. Membrane bare.

    Description

    Female (n = 79)

    Head: Eyes (Figure 3C) bare, contiguous for 1 ommatidium. Flagellum (Figure 3B): Lengths of flagellomeres: 65/49/50/54 /55/52/53/54/69/77/87/92/119 μιη. Mean antennal ratio (AR) 1.06 (0.95-1.09). Mean number and distribution of sensilla coeloconica on flagellomeres 1-13: 3.30/0/0.01/0/0.1/0.0/0.2/0/1 .73/1.95/1.87/2.73/2.79; range in number of sensilla coeloconica on flagellomeres 1-13: 2-5/0/0-1/0/0-1/0/0-1/0/1-3/1-3/1-2/1-5/2-4. Number of sensilla coeloconica on flagellomeres: 15 (11-20). Number and distribution of sensilla chaetica on flagellomeres 1-13: 11/7/6/6/6/6/6/4/2/2/4/4/2. Number and distribution of long and short blunt-tipped sensilla trichodea on flagellomeres 1-8: two long (LL) on flagellomere 1 and 8, two long (LL) and one short (c) on flagellomeres 2-7. Palpus (Figure 3D) with lengths of segments 1+2-5: 96/104/32/40. Mean palpal ratio (PR) 2.48 (2.21-2.74); third segment moderately inflated with shallow, scattered sensory pits, grouped in the distal half of the segment. Mean P/H ratio 0.80 (0.75-0.88). Mandible with 16 (15-17) teeth (Figure 3E).

    Thorax: Scutum ochreous in fresh specimens, with two pale yellow clearly visible lines on scutum, in alcohol preserved or -mounted specimens the lines are faded but still visible (Figure 3F). Halters pale. Wing (Figure 3A): Mean length of wing 1.86 (1.39-2.06) mm. Mean costal ratio (CR) 0.58 (0.56-0.60). Mean wing length/width ratio 1.86 (1.39-2.06). Radial cells completely formed. Wing with prominent dark and pale markings; round dark spot, surrounded by a pale ring-like area in cell cua1; large 3rd poststigmatic pale spot reaching wing margin in cell r3; veins M1, M2 and CuA1 pale at wing margin 2nd radial cell ending in a pale 2nd costal spot. Legs (Figure 3H + I); only middle leg bearing a pair of short, erect spines apically on tarsomeres 1-3, and a single spine on tarsomere 4. Hindtibial comb with 6-8 spines, with the 2nd or 3rd from the spur being the longest. Mean tarsal ratio (T/R) 1.71 (1.63-1.79).

    Abdomen: Two, fully well-developed, ovoid spermathecae (Figure 3G), third rudimentary and sclerotised ring (approximately 9.84 × 6.39 μm), slightly unequal in size, measuring 66.05 × 42.15, 63.31 × 42.17 and 23.54 × 4.01 μm.

    Male (Figure 4) (n = 33)

    Head (Figure 4C): Eyes bare, separated by less than half the width of an ommatidia. Flagellum (Figure 4B): Lengths of flagellomeres 1-13: 135/59/55/52/52/52/54/49/ 48/50/166/136/145 μm. Mean antennal ratio (AR) 1.07 (1.05-1.11). Mean number and distribution of sensilla coeloconica on flagellomeres 1-13: 2.5/0/0/0/0/0/0/0/0/0/1/2.8/2; range in number of sensilla coeloconica on flagellomeres 1-13: 2-3/0/0/0/0/0/0/ 0/0/0/1/2-3/1-3. Number and distribution of sensilla chaetica on flagellomeres 11-13: 6/6/2. Number and distribution of long and short-tipped sensilla trichodea on flagellomeres 1-8: two long on flagellomere 1, two long and one short on flagellomeres 2-4, and one long and one short on flagellomeres 5-8. Palpus (Figure 4C): Mean PR 3.22 (3.09-3.28); 3rd segment of maxillary palpus slender with shallow sensory pit. Mean P/H 0.51 (0.48-0.54).

    Thorax: Scutum ochreous in fresh specimens, with two pale yellow clearly visible lines on scutum, in alcohol preserved or slide-mounted specimens the lines are faded but still visible. Wing (Figure 4A). Mean length 1.78 (1.52-2.00) mm. Mean costal ratio (CR) 0.56 (0.55-0.57). Mean wing length/width ratio 2.93 (2.87-3.00). Legs: only middle leg bearing a pair of short, erect spines apically on tarsomeres 1-3, and a single spine on tarsomere 4.

    Abdomen: Genitalia (Figure 4D-4F) Ninth tergum with short, slender apicolateral processes, caudal margin with a narrow mesal cleft. Ninth sternum with a broad, shallow caudomedian emargination; ventral membrane not spiculate. Gonocoxite with short ventral root and moderately long dorsal root, inner margin of gonocoxite spinose. Aedeagus with a deep, V-shaped basal arch, lateral arms slender; distal median process moderately short, slender, with rounded apex. Paramere with slender stem, tapering to a pointed apex with minute setae.

    Etymology

    Named in honour of Sir Arnold Theiler in recognition of his work on diseases of veterinary importance and particularly AHS, in South Africa.

    Immatures

    The larval habitat and immature stages of C. theileri sp. n. remains undescribed.

    Bionomics

    The blood feeding habits of the adult female of C. theileri sp. n. are not known. Adults have been collected with light traps set at cattle kraals, sheep pens, and at horse stables (Schütte 2012)

    Distribution

    South Africa; Northern and Western Cape Provinces (Figure 7).

    Biomes: Deserts and Xeric Shrublands; Mediterranean Forests, Woodlands, and Scrub; Tropical and Subtropical Moist Broadleaf Forests (Mucina and Rutherford 2006).

    Terrestrial ecoregions: Succulent Karoo; Montane Fynbos and Renosterveld; Knysna-Amatole Montane Forests (Burgess et al. 2004).

    Culicoides brucei Austen 1909

    (Figures 5, 6, 7, 8, Table 1, 2 and Supplementary Table 1)

    Synonyms:

    C. brucei Austen, 1909: 282. Uganda.

    C. pseudopulicaris Goetghebuer, 1935d: 173. Democratic Republic of the Congo.

    C. hirtius de Meillon and Lavoipierre, 1944: 58. South Africa.

    Material examined

    (29 females, 5 males)

    Specimens examined: South Africa: Eastern Cape Province: East London, GPS: 27.95, -32.9483, 11/iv/2005, K Labuschagne, 2 females; Middelburg, GPS: 25.01667, -31.4833, 21/xii/1970, EM Nevill, 2 males; Gauteng Province: Onderstepoort, GPS, 28.19, -25.65, 10/xii/1977, R Meiswinkel, 2 females, 2 males, 1/ix/1967, EM Nevill, 2 females, 28/i/2004, 28/xi/2007, 26/iv/2010, K Labuschagne, 5 females; KwaZulu Natal Province, Allerton, GPS, 30.36, -29.57, 23/xii/1970, R Nixon, 2 females, Underberg, GPS: 29.61, -29.67, 1/iii/2003, K Labuschagne, 1 female, Umlalazi Nature Reserve, GPS: 31.72, -29.01, 17/ix/1990, R Meiswinkel, 7 females; Limpopo Province, Mabula, GPS: 27.93, -24.75, 12/xii/1996, A Grimbeek, 1 female, Nylstroom, GPS: 28.39, -24.69, 30/ix/1996, R Meiswinkel, 1 female, 1 male; Mpumalanga Province, Haenertzburg, GPS: 29.94, -23.95, 21/iv/1983, R Meiswinkel, 1 female; Western Cape Province, Piketberg GPS: 18.71, -32.72, 7/iii/2007, K Labuschagne, 1 female, Beaufort West, GPS: 22.84, -32.07, 1/ii/2006, K Labuschagne, 2 females; Namibia: Windhoek, GPS: 17.14, -22.74, 19/iii/1980, R Meiswinkel, 1 female; Kenya, Koru West, GPS: 35.26, -0.18, 8/viii/1994, R Meiswinkel, 1 female; Zimbabwe, Harare, GPS: 31.05, -17.80, 1/iv/2002, K Labuschagne, 2 females. Accession numbers RSA1622 to RSA 1664.

    Diagnosis

    Female: Small species, eyes contiguous. Wing with prominent dark and pale markings, round dark spot, surrounded by a pale ring-like area in cell cua1, large pale spot reaching wing margin in cell r3, 2nd radial cell ending in a pale 2nd costal spot. Sensilla coeloconica distribution on flagellomeres 1, 9-13. Third segment of maxillary palpus moderately inflated, with scattered sensilla grouped in round to irregular, shallow pits. Hindtibial comb with 6-8 spines. Female abdomen with 2 ovoid spermathecae and a rudimentary 3rd and sclerotised ring present at junction of ducts (Glick 1990).

    Male: Ninth tergum with small apicolateral processes, caudal margin slightly rounded. Gonocoxite usually with short ventral root and moderately long dorsal root, inner margin of gonocoxite spinose. Aedeagus without a basal bar-like band or dorsal "peg"; distal median process stout or tapering to a rounded or blunt apex. Parameres separate, usually sharply bent laterally near base, stem usually moderately long and slender, tapering distally to a slender, pointed apex with minute setae. Membrane bare.

    Description

    Female: (n = 35)

    Head: Eyes (Figure 5B) bare, contiguous for 1 to 2 ommatidium. Flagellum (Figure 5D): Lengths of flagellomeres: 45/33/34/38 /39/39/37/36/46/46/50/55/8484 μm. Mean antennal ratio (AR) 0.94 (0.92-0.95). Mean number and distribution of sensilla coeloconica on flagellomeres 1-13: 3.1/0/0/0/0/0/0/0/1/1/1/2.6 /2.5; range in number of sensilla coeloconica on flagellomeres 1-13: 2-5/0/0/0/0/0/0/0/1/1-2/1-2/2-4/2-5. Number of sensilla coeloconica on flagellomeres: 11 (9-13). Number and distribution of sensilla chaetica on flagellomeres 1-13: 11/7/6/6/6/6/6/4/2/2/4/4/2. Number and distribution of long and short blunt-tipped sensilla trichodea on flagellomeres 1-8: two long (LL) on flagellomere 1, two long (LL) and one short (c) on flagellomeres 2-8. Palpus (Figure 5C) with lengths of segments 1+2-5: 85/83/31/34. Mean palpal ratio (PR) 3.15 (3.05-3.54); third segment moderately inflated with shallow, scattered sensory pits, grouped in the distal half of the segment. Mean P/H ratio 0.83 (0.80-0.86). Mandible with 16 (15-17) teeth (Figure 5F). Thorax: Scutum ochreous in fresh specimens, with two pale yellow clearly visible lines on scutum, in alcohol preserved or slide-mounted specimens the lines are faded but still visible (Figure 5G). Halters pale. Wing (Figure 5A): Mean length of wing 1.23 (0.94-1.49) mm. Mean costal ratio (CR) 0.56 (0.54-0.58). Mean wing length/width ratio 2.13 (2.07-2.18). Radial cells completely formed. Wing with prominent dark and pale markings; round dark spot, surrounded by a pale ring-like area in cell cua1; large 3rd poststigmatic pale spot reaching wing margin in cell r3; veins M1, M2 and CuA1 pale at wing margin 2nd radial cell ending in a pale 2nd costal spot. Legs (Figure 5E); only middle leg bearing a pair of short, erect spines apically on tarsomeres 1-3, and a single spine on tarsomere 4. Hindtibial comb with 6-8 spines, with the 2nd or 3rd from the spur being the longest. Mean tarsal ratio (T/R) 1.71 (1.63-1.81; n = 35). Abdomen: Two, fully well-developed, ovoid spermathecae (Figure 5H), third rudimentary and sclerotised ring (approximately 9.84 × 6.39 μm), unequal in size, measuring 66.05 × 42.15, 63.31 × 42.17 and 30.84 × 11.01 μm.

    Male: (n = 8)

    Head (Figure 6B): Eyes bare, separated by less than halfthe width of an ommatidia. Flagellum (Figure 6B): Lengths of flagellomeres 1-13: 102/41/41/40/41/40/40/38/37/44/89/76/100 μιη. Mean antennal ratio (AR) 0.90 (0.89-0.92). Mean number and distribution of sensilla coeloconica on flagellomeres 1-13: 2.5/0/0/0/0/0/0/0/0/0/1/2.8/2; range in number of sensilla coeloconica on flagellomeres 1-13: 2-3/0/0/0/0/0/0/0/0/0/1/2-3/1-3. Number and distribution of sensilla chaetica on flagellomeres 11-13: 6/6/2. Number and distribution of long and short-tipped sensilla trichodea on flagellomeres 1-8: two long on flagellomere 1, two long and one short on flagellomeres 2-4, and one long and one short on flagellomeres 5-8

    Palpus (Figure 6B): Mean PR 3.46 (3.40-3.51); 3rd segment of maxillary palpus slender with shallow sensory pit. Mean P/H 0.87 (0.85-0.88).

    Thorax: Scutum ochreous in fresh specimens, with two pale yellow clearly visible lines on scutum, in alcohol preserved or slide-mounted specimens the lines are faded but still visible. Wing (Figure 6A). Mean length 1.05 (0.94-1.12) mm. Mean costal ratio (CR) 0.55 (0.54-0.56). Mean wing length/width ratio 2.51 (2.47-2.46). Legs: only middle leg bearing a pair of short, erect spines apically on tarsomeres 1-3, and a single spine on tarsomere 4.

    Abdomen: Genitalia (Figure 6C-6E) Ninth tergum with short, slender apicolateral processes, caudal margin with a narrow mesal cleft. Ninth sternum with a broad, shallow caudomedian emargination; ventral membrane not spiculate Gonocoxite with short ventral root and moderately long dorsal root, inner margin of gonocoxite spinose. Aedeagus with a deep, V-shaped basal arch, lateral arms slender; distal median process moderately short, slender, with rounded apex. Paramere with slender stem, tapering to a pointed apex with minute setae.

    Immatures

    The immature stages of C. brucei remain undescribed. The authors (unpublished) have collected adults with emergence traps placed over kikuyu grass covered, waterlogged clay soils in South Africa.

    Bionomics

    Austen (1909) described C. brucei from 3 female specimens taken by D. Bruce while these females were biting humans in the vicinity of the Mianga River, Uganda Protectorate. Braverman and Hulley (1979) stated that based on the low number of antennal and palpal sensilla that C. brucei feeds primarily on large mammals. Based on precipitin tests of blood engorged females the hosts of C. brucei include horses, and other mammals (Braverman and Hulley 1979), as well as birds and bovines (Walker and Boreham 1976). In Nigeria, Dipeolu (1976) collected C. brucei in low numbers near cattle and small ruminant pens in the forest and plateau regions. Lubega and Khamala (1976) reared adults in Kenya from water-logged mud, from freshwater marshes, from mud mixed with animal faeces, from puddles, slow-flowing streams, artificial drainage trenches, and water-filled concrete troughs for watering livestock.

    Culicoides brucei has been taken by light trap throughout the year in the Afrotropical Region. Khamala (1971) collected adults from forested zones in Kenya and from various savanna zones in Kenya, Tanzania, and Uganda. Walker and Boreman (1976) collected C. brucei in Kenya from high-altitude forests and grasslands, moist Combretum woodland and grassland, semi-arid Acacia woodland and grassland, and arid Acacia-Commiphora bushland. Adults have been collected with light traps set at cattle kraals, sheep pens, horse stables (Meiswinkel et al. 2000; Schütte 2012) and at the Elephant, Buffalo and White Rhinoceros camps at the National Zoological Gardens of South Africa (Labuschagne et al. 2007). In the Kruger National Park, C. brucei was collected at the bomas, and in traps set in the bush (Meiswinkel 1995).

    It is suspected that C. brucei and C. magnus may play a role in the transmission of AHSV in the field. In the laboratory, AHSV was isolated after ten days from field collected specimens of C. brucei that were fed on a high titre of AHSV (Venter et al. 2009). Similarly, AHSV, BTV, EHDV and EEV have been isolated from C. magnus in the laboratory (Nevill et al. 1992; Paweska et al. 2003, 2004, 2005; Paweska and Venter 2004, Venter et al. 2004, 2009).

    Distribution

    Botswana, Ethiopia, Ivory Coast, Kenya, Namibia, Nigeria, South Africa, Tanzania, Uganda, Zaire, Zimbabwe (Glick 1990).

    South Africa: Eastern-, Northern- and Western Cape, Free State, KwaZulu-Natal, Mpumalanga, Gauteng, North-West and Limpopo provinces (Figure 7).

    Biomes: Deserts and Xeric Shrublands; Mangroves; Mediterranean Forests, Woodlands, and Scrub; Montane Grasslands and Shrublands; Tropical and Subtropical Grasslands, Savannas, Shrublands, and Woodlands; Tropical and Subtropical Moist Broadleaf Forests (Mucina and Rutherford 2006).

    Terrestrial ecoregions: Nama Karoo; Namibian Escarpment Woodlands; Succulent Karoo; southern African Mangroves; Albany thickets; Montane Fynbos and Renosterveld; Lowland Fynbos and Renosterveld; Drakensberg Montane Grasslands, Woodlands, Forests; Highveld Grasslands; southern Africa Bushveld; southern Miombo Woodlands; Zambezian Baikiaea Woodlands; Zambezian and Mopane Woodlands; Knysna-Amatole Montane Forests; KwaZulu-Cape Coastal Forest Mosaic; Maputaland Coastal Forest Mosaic (Burgess et al. 2004).

     

    SEQUENCING AND PHYLOGENETIC ANALYSIS

    The phylogenetic relationship, using the partial COI sequences of C. baltusi sp. n. (n = 19) and C. theileri sp. n. (n = 11) isolates, were compared with closely related species from the same geographic area, representing the other subgenera or groups previously described in the region (Figure 8). Sequences from the two newly described species clustered into unique sister lineages, indicated that these are novel species (Figure 8). The C. baltusi sp. n. isolates shared between 99.07 to 100% sequence identity within the sub-group and only between 80.83 and 86.71% sequence identity with the other Culicoides species (Table 1). Similarly, the C. theileri sp. n. isolates shared between 99.54 to 100% sequence identity within the sub-group and only between 80.56 and 86.09% sequence identity with the other Culicoides species (Table 1). New consensus COI gene sequences were deposited in GenBank (Accession numbers: PV836640-PV836680 (Supplementary Table 2)).

     

    DISCUSSION

    Morphologically and genetically Culicoides baltusi sp. n. and C. theileri sp. n. are related to C. brucei. It is proposed that these two species be placed in the subgenus Culicoides and that C. baltusi sp. n. be placed with C. brucei in the Brucei group of this subgenus. The male genitalia of these three species are indistinguishable from each other. Morphologically C. theileri sp. n. is the easiest to distinguish from C. brucei, due to its size, coloration and wing pattern. Culicoides baltusi sp. n. is more difficult, but the wing pattern differs mainly in having the apices of veins Ml, M2 and CuA1 dark as opposed to the apices being pale in C. brucei. Generally, the wing pattern of C. baltusi sp. n. is paler, and the pale areas are larger, particularly the distal pale spot in cell r3 that reaches or nearly reaches the wing margin. Table 2 shows the various characters useful in female identification and how they differ between these three species.

    These three species can be distinguished by their size and wing patterns. Though the wing patterns are similar: veins Ml, M2 and CuAl are pale at the wing margin in C. theileri sp. n. and C. brucei, while the veins are dark in C. baltusi sp. n. The sensilla coeloconica distribution on the flagellomeres are 1, 9-13 in C. baltusi sp. n., C. theileri sp. n. and C. brucei, though occasionally sensilla coeloconica is also present on flagellomeres 3, 5, and 7 in C. theileri sp. n. These three species can also be differentiated by size with C. brucei the smallest, followed by C. baltusi sp. n. and C. theileri sp. n. being the largest.

    Culicoides baltusi sp. n. is similar to C. sylvicola and C. sellersi in having the apices of the veins Ml, M2 and CuA1 dark, but differs from C. sylvicola in the wing pattern being much paler with more extensive pale areas (Glick 1990). Khamala and Kettle (1971) describe C. sylvicola as having "less well-defined pale spots" and gives the PR as 3.42; this is much higher than that of C. baltusi sp. n. (PR = 2.83). The measurements and ratios for all the different characters are similar for C. sellersi and C. baltusi sp. n.; distinguishing between these two species is therefore more difficult. The CR and H/P ratios do differ although their ranges overlap; the CR for C. baltusi sp. n. is higher (0.59 vs 0.52) while the H/P ratio is lower (1.34 vs 1.51).

    Of these three species, C. theileri sp. n. has the most restricted distribution occurring only the Northern and Western Cape Provinces. On the other hand, C. baltusi sp. n. and C. brucei are widely distributed throughout South Africa, occurring in all nine provinces, and also in Namibia (Liebenberg et al. 2016), Zimbabwe and Botswana.

    The vector capacity of the two new species being described is not known, though several other species within the subgenus Culicoides are known field or laboratory vectors of several virus including AHSV, BTV, EHDV and EEV. Culicoides brucei, C. magnus and the two new species, C. baltusi sp. n., C. theileri sp. n. are related to the Palearctic species C. pulicaris and C. punctatus, both field vectors of BTV in Europe. In the laboratory virus have been isolated from C. brucei and C. magnus after being artificially fed on a high titre of AHSV, BTV, EHDV or EEV (Nevill et al. 1992; Paweska et al. 2003, 2004, 2005; Paweska and Venter 2004; Venter et al. 2004, 2009).

    Based on morphology and partial sequences of the COI gene, the two newly described species are distinctive, yet the specimens belonging to these two species share significant sequence homology amongst the subgenus to which these species belong, in contrast to the Similis or Milnei groups or the subgenus Avaritia present in the geographical region. The description of these two new species increases our understanding of the diversity and distribution of Culicoides species in southern Africa.

     

    ACKNOWLEDGEMENTS

    This work was supported by the Agricultural Research Council-Onderstepoort Veterinary Research (ARC-OVR).

    *Rudy Meiswinkel is credited as co-author of the two new species as he contributed to the species descriptions prior to his death in 2022.

     

    REFERENCES

    Austen EE. 1909. New African phlebotomic Diptera in the British Museum (Natural History). Annals and Magazine of Natural History (Series 8) 3: 280-284.         [ Links ]

    Blackwell A. 2001. Recent advances on the ecology and behaviour of Culicoides spp. in Scotland and the prospects for control. Veterinary Bulletin. 71: 1-8.         [ Links ]

    Boorman J. 1989. Culicoides (Diptera: Ceratopogonidae) of the Arabian Peninsula with notes on their medical and veterinary importance. Fauna of Saudi Arabia. 10: 160-224.         [ Links ]

    Boorman J, Dipeolu OO. 1979. A taxonomic study of adult Nigerian Culicoides Latreille (Diptera: Ceratopogonidae) species. Entomological Society of Nigeria Occassional Publication 22. Ibadan: University of Ibadan.         [ Links ]

    Borkent A, Dominiak P. 2020. Catalog of the biting midges of the world (Diptera: Ceratopogonidae). Zootaxa. 4787: 1-377. https://doi.org/10.11646/zootaxa.4787.1.1        [ Links ]

    Braverman Y, Hulley PE. 1979. The relationship between the numbers and distribution of some antennal and palpal sense organs and host preference in some Culicoides (Diptera: Ceratopogonidae) from southern Africa. Journal of Medical Entomology. 15: 419-424. https://doi.org/10.1093/jmedent/15.5-6.419        [ Links ]

    Braverman Y, Phelps RJ. 1981. Species composition and blood-meal identification in samples of Culicoides (Diptera: Ceratopogonidae) collected near Salisbury, Zimbabwe. Journal of the Entomological Society of Southern Africa. 44: 315-323.         [ Links ]

    Burgess N, Hales JA, Underwood E, Dinerstein E, Olson D, Itoua I, Schipper J, Ricketts T, Newman K. 2004. Terrestrial ecoregions of Africa and Madagascar: a conservation assessment. Washington (DC): Island Press. https://www.researchgate.net/publication/292588815        [ Links ]

    Genomics Workbench CLC. 20.0 (QIAGEN). www.qaigenbioinformatics.com

    Dipeolu OO. 1976. Species distribution and abundance of Culicoides Latreille (Diptera, Ceratopogonidae) in Nigeria. Bulletin of Entomological Research. 66: 685-693. https://doi.org/10.1017/S0007485300010750        [ Links ]

    Dyce AL. 1969. The recognition of nulliparous and parous Culicoides (Diptera: Ceratopogonidae) without dissection. Journal of the Australian Entomological Society. 8: 11-15. https://doi.org/10.1111/j.1440-6055.1969.tb00727.x        [ Links ]

    Folmer O, Black M, Hoeh W, Lutz R, Vrijenhoek R. 1994. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology. 3: 294-299, viewed n.d., from https://www.mbari.org/wp-content/uploads/2016/01/Folmer_94MMBB.pdf        [ Links ]

    Glick JI. 1990. Culicoides biting midges (Diptera: Ceratopogonidae) of Kenya. Journal of Medical Entomology. 27: 85-195. https://doi.org/10.1093/jmedent/27.2.85        [ Links ]

    Iczn I. 2012. International Commission on Zoological Nomenclature. Amendment of articles 8, 9, 10, 21 and 78 of the International Code of Zoological Nomenclature to expand and refine methods ofpublication. ZooKeys. 219: 1-10. https://doi.org/10.3897/zookeys.219.3994        [ Links ]

    Khamala CPM. 1971. Ecological distribution of East African Culicoides Latreille (Dipt., Ceratopogonidae) as shown by light-traps. Bulletin of Entomological Research. 60: 549-557. https://doi.org/10.1017/S0007485300042310        [ Links ]

    Khamala CPM, Kettle DS. 1971. The Culicoides Latreille (Diptera: Ceratopogonidae) of East Africa. Transactions of the Royal Entomological Society of London. 123: 1-95. https://doi.org/10.1111/j.1365-2311.1971.tb00840.x        [ Links ]

    Labuschagne K. 2016. The Culicoides Latreille (Diptera: Ceratopogonidae) species of South Africa. PhD thesis, University of Pretoria, South Africa.         [ Links ]

    Labuschagne K, Meiswinkel R, Liebenberg D, Van Zyl C, Van Schalkwyk A, Scholtz C. 2023. Description of Culicoides truuskae sp. n. (Diptera: Ceratopogonidae) from southern Africa. Onderstepoort Journal of Veterinary Research. 90: a2072. https://doi.org/10.4102/ojvr.v90i1.2072        [ Links ]

    Labuschagne K, Gerber LJ, Espie I, Carpenter S. 2007. Culicoides biting midges at the National Zoological Gardens of South Africa. Onderstepoort Journal of Veterinary Research. 74: 343-347. https://doi.org/10.4102/ojvr.v74i4.120        [ Links ]

    Liebenberg D, Piketh S, Labuschagne K, Venter G, Greyling T, Mienie C, De Waal T, Van Hamburg H. 2016. Culicoides species composition and environmental factors influencing African horse sickness distribution at three sites in Namibia. Acta Tropica. 163: 70-79. https://doi.org/10.1016/j.actatropica.2016.07.024        [ Links ]

    Lubega R, Khamala CPM. 1976. Larval habitats of common Culicoides Latreille (Diptera, Ceratopogonidae) in Kenya. Bulletin of Entomological Research. 66: 421-425. https://doi.org/10.1017/S0007485300006829        [ Links ]

    Meiswinkel R. 1995. Afrotropical Culicoides: Biosystematics of the Imicola group, subgenus Avaritia (Diptera: Ceratopogonidae). With special reference to the epidemiology of African horse sickness. MSc thesis, University of Pretoria, South Africa. https://repository.up.ac.za/handle/2263/24413        [ Links ]

    Meiswinkel R, Baylis M, Labuschagne K. 2000. Stabling and the protection of horses from Culicoides bolitinos (Diptera: Ceratopogonidae), a recently identified vector of African horse sickness. Bulletin of Entomological Research. 90: 509-515. https://doi.org/10.1017/S0007485300000626        [ Links ]

    Meiswinkel R, Venter GJ, Nevill EM. 2004. Vectors: Culicoides spp. In: Coetzer JAW, Tustin RC, editors. Infectious Diseases of Livestock with Special Reference to southern Africa. Cape Town: Oxford University Press. pp. 93-136.

    Mucina L, Rutherford MC, editors. 2006. The vegetation of South Africa, Lesotho and Swaziland, Strelitzia 19. Pretoria: South African National Biodiversity Institute. http://biodiversityadvisor.sanbi.org/wp-ontent/uploads/2015/12/Strelitzia_19_2006_Part_1.pdf        [ Links ]

    Nevill EM, Anderson D. 1972. Host preference of Culicoides midges (Diptera: Ceratopogonidae) in South Africa as determined by precipitin test and light trap catches. Onderstepoort Journal of Veterinary Research. 39: 147-152.         [ Links ]

    Nevill EM, Erasmus BJ, Venter GJ. 1992. A six-year survey of viruses associated with Culicoides biting midges throughout South Africa (Diptera: Ceratopogonidae). In: Walton TE, Osburn BI, editors. Proceedings of the 2nd International Symposium on Bluetongue, African horse sickness and related orbiviruses, Paris, France, 17-21 June 1991. Boca Raton: CRC Press. Pp. 314-319.

    Paweska JT, Venter GJ, Mellor PS. 2002. Vector competence of South African Culicoides species for bluetongue virus serotype 1 (BTV-1) with special reference to the effect of temperature on the rate of virus replication in C. imicola and C. bolitinos. Medical and Veterinary Entomology. 16: 10-21. https://doi.org/10.1046/j.1365-2915.2002.00334.x        [ Links ]

    Paweska JT, Prinsloo S, Venter GJ. 2003. Oral susceptibility of South African Culicoides species to live-attenuated serotype-specific vaccine strains of African horse sickness virus (AHSV). Medical and Veterinary Entomology. 17: 436-447. https://doi.org/10.1111/j.1365-2915.2003.00467.x        [ Links ]

    Paweska JT, Venter GJ. 2004. Vector competence of Culicoides species and the seroprevalence of homologous neutralizing antibody in horses for six serotypes of equine encephalosis virus (EEV) in South Africa. Medical and Veterinary Entomology. 18: 398-407. https://doi.org/10.1111/j.0269-283X.2004.00524.x        [ Links ]

    Paweska JT, Venter GJ, Hamblin C. 2005. A comparison of the susceptibility of Culicoides imicola and C. bolitinos to oral infection with eight serotypes of epizootic haemorrhagic disease virus. Medical and Veterinary Entomology. 19: 200-207. https://doi.org/10.1111/j.0269-283X.2005.00560.x        [ Links ]

    QGIS Development Team. 2022. QGIS Geographic Information System. Open Source Geospatial Foundation Project. http://qgis.osgeo.org

    Riddin MA, Venter GJ, Labuschagne K, Villet MH. 2019. Blood meal analysis of Culicoides midges collected near horses, donkeys and zebras in the Eastern Cape, South Africa. Medical and Veterinary Entomology. 33: 467-475. https://doi.org/10.1111/mve.12381        [ Links ]

    Schütte C. 2012. Seroprevalence of African horse sickness virus and equine encephalosis virus in equids and abundance of Culicoides midges in Namaqualand, South Africa. MSc thesis, University of Pretoria, South Africa. http://hdl.handle.net/2263/30900        [ Links ]

    Tamura K, Stecher G, Peterson D, Filipski A, Kumar S. 2013. MEGA 6: molecular evolutionary genetics analysis version 6.0. Molecular Biology and Evolution. 30: 2725-2729. https://doi.org/10.1093/molbev/mst197        [ Links ]

    Venter GJ, Gerdes GH, Mellor PS, Paweska JT. 2004. Transmission potential of South African Culicoides species for live-attenuated bluetongue virus. Veterinaria Italiana. 40: 198-203.         [ Links ]

    Venter GJ, Wright IM, Van der Linde TC, Paweska JT. 2009. The oral susceptibility of South African field populations of Culicoides to African horse sickness virus. Medical and Veterinary Entomology. 23: 367-378. https://doi.org/10.1111/j.1365-2915.2009.00829.x        [ Links ]

    Walker A, Boreham P. 1976. Blood feeding of Culicoides (Diptera, Ceratopogonidae) in Kenya in relation to the epidemiology of bluetongue and ephemeral fever. Bulletin of Entomological Research. 66: 181-188. https://doi.org/10.1017/S000748530000660X        [ Links ]

     

     

    Correspondence:
    K Labuschagne
    email: labuschagnek@arc.agric.za

    Received: 13 August 2025
    Accepted: 9 December 2025

     

     

    SUPPLEMENTARY MATERIAL
    Supplementary tables 1 and 2 are available as a separate pdf

    ZOOBANK
    Article: urn:lsid:zoobank.org:pub:03ABA088-882C-4E87-99BB-3B6473C68B33
    Culicoides baltusi: urn:lsid:zoobank.org:act:016811CD-E4E0-4CDB-AB4D-772716A432B0
    Culicoides theileri: urn:lsid:zoobank.org:act:3A4CDA1E-CD68-4284-AF7D-CC31C7572001